RegulonDB RegulonDB 10.10: Gene Sequence
ybjH gene sequence


Size: 285        A: 59  T: 75  G: 79  C: 72

Fasta

 

>ybjH E. coli K12. Version NC_000913.3 GI:556503834
atgattatgaaaaattgtctactgttgggcgcgcttttaatgggctttactggtgtggcg
atggcgcaaagtgtcaccgtcgatgtgccgagtggatacaaagtggttgtggttcctgat
tcagtcagcgttccacaagcggtcagcgtcgcgactgtgccgcaaaccgtctatgtggct
cctgcgccagctccggcttaccgcccgcatccttatgttcgccatcttgccagcgtaggt
gaagggatggttatcgaacaccagattgacgaccatcaccattaa
              
                            

Download fasta file
RegulonDB