RegulonDB RegulonDB 10.9: Gene Sequence
ybjI gene sequence


Size: 816        A: 237  T: 207  G: 208  C: 164

Fasta

 

>ybjI E. coli K12. Version NC_000913.3 GI:556503834
atgagcattaaattaattgcggtagacatggatggtactttcttaagcgatcaaaaaacc
tataaccgtgagcggtttatggctcagtatcagcaaatgaaagcacaaggaattcgcttt
gtagtcgccagcgggaatcaatattatcagttgatctctttcttccctgaaattgctaat
gaaattgcctttgtggctgaaaacggcggctgggtagtgagcgaaggcaaagatgttttt
aatggcgagctatcgaaggatgcgtttgctactgtcgtggaacatttgctgacgcgcccg
gaagtggaaattattgcctgcggaaaaaatagtgcctatacactcaaaaaatatgacgat
gccatgaaaacggtggcggaaatgtattatcaccgtctggaatacgtcgataactttgac
aacttagaggatatcttctttaagtttggcctgaatctttccgatgaactgattccacaa
gtacaaaaagcattacatgaggccatcggcgatattatggtgtcggtccacaccggcaac
ggcagcatcgatctgattatccccggcgtacataaagccaatggccttcgccaactgcag
aaattatggggaatagacgacagcgaagtggtggtctttggcgatggcggtaacgatatt
gagatgctgcgtcaggcaggctttagttttgcaatggaaaatgccggtagcgcggtcgtc
gcagcggcaaaataccgcgcaggctccaataaccgtgaaggcgtactggatgtgatcgat
aaagttcttaaacacgaagcgccatttgaccaataa
              
                            

Download fasta file
RegulonDB