RegulonDB RegulonDB 10.9: Gene Sequence
ybjJ gene sequence


Size: 1209        A: 207  T: 338  G: 364  C: 300

Fasta

 

>ybjJ E. coli K12. Version NC_000913.3 GI:556503834
atgaccgtaaattcttcacgtaatgcattgaaacgccgaacctgggcgctgtttatgttc
ttctttttgccaggcctgttaatggcgtcctgggcaacccgtacgcctgctatccgcgat
attctctctgtctcgatcgctgaaatgggcggtgttctctttggtctgtcgatcggttcg
atgagcggtattctctgctcggcgtggttagtgaaacgctttgggacacgtaatgtcatc
ctggtcacgatgtcctgcgcattgatcgggatgatgatattaagtctggcactctggctg
acatcgcccctgctctttgccgttggtctcggcgtctttggggcaagttttggttctgcg
gaagtggcgataaacgttgaaggtgctgccgttgagcgagaaatgaataagacggttttg
ccgatgatgcacggtttttatagcctgggcacgctggcaggcgcaggtgtcgggatggca
ctgacggcctttggcgttccggcaacggtgcacattttattggcggcgctggtaggtatc
gcacctatttatatcgccattcaggcaatccctgacggtacgggcaaaaatgctgccgat
ggcacccagcatggcgaaaaaggcgtacctttttatcgcgatatccagttgctgctgata
ggtgttgtggtgctggcgatggcctttgccgaaggttctgccaacgactggttaccctta
ttaatggttgacggtcacggttttagccctacttccggctcgctgatttatgccggtttt
accctggggatgaccgttggacgcttcaccggcggttggttcatcgaccgttacagtcgc
gttgccgtggttcgggccagtgcactaatgggggcgttgggtattgggctgattattttt
gtcgatagcgcctgggtcgctggggtgtctgttgtactctggggactgggtgcctcgctg
ggcttcccgctgaccatttctgccgccagcgataccggccccgatgcaccaacccgcgtc
agtgtggtagcaacgaccggttatctggctttcctcgtcgggccgccgctgctgggctat
ctcggcgaacattatggattacgtagtgcaatgctggttgtactggcgctggttattctc
gcggctattgtcgcgaaagccgtcgccaaacccgataccaaaacgcagacggcgatggag
aatagttga
              
                            

Download fasta file
RegulonDB