RegulonDB RegulonDB 10.9: Gene Sequence
ybjL gene sequence


Size: 1686        A: 358  T: 459  G: 468  C: 401

Fasta

 

>ybjL E. coli K12. Version NC_000913.3 GI:556503834
gtgaatataaacgtcgccgaattgttaaatgggaattacattctgttattatttgtggtc
ctcgcgcttgggctatgtctcggaaagttacgacttggttcgatccaactgggtaattcc
attggcgttttagtcgtatcgctgttattaggccaacaacatttcagcattaacaccgat
gcgcttaatcttggctttatgctgtttattttctgcgtcggggtcgaagccggaccgaac
tttttttccattttttttcgcgatgggaaaaattacctaatgttagcactggtgatggtt
ggcagtgcgctggtgatcgccttagggttaggtaagctgtttggctgggatattggcctg
acggccggtatgttagcaggctctatgacgtcgacaccggttctggtcggtgctggcgat
acactgcgtcattccggcatggaaagcaggcagctctcactggcactggataatctgagc
ctcgggtatgccttaacctatttaatcggtctggtgagtttgattgttggtgcgcgttac
ttgccgaaattgcagcatcaggacttacagaccagcgcccagcaaatcgcccgcgaacgt
ggcctggacactgatgccaaccgtaaggtttatttaccggtgatccgcgcctatcgcgtc
ggcccggaactggtggcctggaccgacggcaaaaatctgcgtgaactgggtatttatcga
caaaccggctgctacattgaacgtattcgacgtaacgggattctggcaaatccagacggt
gatgccgtgctacaaatgggcgatgaaatagcgttggtaggctatcccgacgcccatgcc
cgactcgatcccagcttccgtaacggtaaagaagttttcgatcgtgaccttctcgacatg
cgtatcgtcactgaagaagtggtcgttaaaaaccataacgctgtaggtaaacgtctcgca
caactgaagttgaccgatcacggttgcttccttaaccgcgtcattcgtagccagattgag
atgccgatagatgacaacgtcgtgcttaacaaaggtgacgttttacaagtcagcggcgat
gcccgccgcgtaaaaaccatcgccgatcgcatcggctttatctcgattcacagccaggtc
actgacctgctggcattctgcgccttctttgttattgggctgatgatcgggatgatcacc
ttccagttcagcacattcagtttcggcatggggaacgctgccgggttgttattcgccgga
attatgctgggctttatgcgtgctaaccacccgaccttcggttacattccgcagggtgca
ttaagcatggtgaaagagttcggcttgatggtgtttatggcaggcgttggtctgagcgcc
ggtagcggtattaataacggcctgggcgcgattggcggtcagatgttgattgccggattg
attgtcagtctggtgcccgtggttatctgtttcttgttcggtgcttatgtattgcgaatg
aaccgcgcgctgttgttcggcgcaatgatgggcgcacgtacctgcgcgccggcaatggag
atcatcagtgatacagctcgcagtaacatcccggcgctgggctatgcgggcacctatgca
atcgccaacgtcctgctgacgctggcagggacaatcatcgtcatggtatggccaggatta
ggataa
              
                            

Download fasta file
RegulonDB