RegulonDB RegulonDB 10.8: Gene Sequence
ybjN gene sequence


Size: 477        A: 109  T: 137  G: 120  C: 111

Fasta

 

>ybjN E. coli K12. Version NC_000913.3 GI:556503834
atgacatcgctggtcgttcctggtctggatacgctgcgtcaatggctcgatgacctgggg
atgagtttttttgaatgtgataactgtcaggctctgcatctgccccatatgcagaatttc
gacggtgtctttgatgccaaaatcgatctgatcgataacacgatcctgttttctgccatg
gcggaagtccgaccttcagccgtattgccgctggcggcggatttatctgccatcaatgcc
agttcgctgaccgtgaaagcatttcttgatatgcaggatgataatctgccaaagctggtg
gtttgccagtctttatccgttatgcagggcgtaacctatgagcagtttgcatggttcgtg
cgtcagagcgaagagcagatttcgatggtcattcttgaagctaatgcccatcaactgctg
ttaccgactgatgatgaagggcaaaacaacgttaccgaaaactatttcctccactga
              
                            

Download fasta file
RegulonDB