RegulonDB RegulonDB 10.8: Gene Sequence
rlmC gene sequence


Size: 1128        A: 248  T: 264  G: 319  C: 297

Fasta

 

>rlmC E. coli K12. Version NC_000913.3 GI:556503834
atgcagtgcgcactttacgacgcgggtcgctgtcgttcctgtcagtggataatgcagccg
attccagagcaactctccgctaaaaccgccgatcttaaaaatctgctcgccgactttccg
gttgaggaatggtgcgcgccggtgtcaggcccggaacaagggtttcgtaataaagccaaa
atggtggtgagtggtagcgttgaaaaaccactgctcggtatgctgcatcgcgatggcaca
ccagaagacctttgtgactgcccgctttatcctgcctcatttgcgcccgtttttgcggcg
ctaaaaccgtttatcgcccgagcggggttaacgccctacaacgtggcgcgtaagcgtggc
gaactgaaatacattctgctgactgaaagccagagtgatggaggcatgatgctgcgcttt
gtactgcgttctgataccaagctggcgcaactgcgtaaggcgctgccgtggttacacgaa
caactaccgcagctgaaagttattaccgtcaatattcagccggtacatatggcgattatg
gaaggggagacggagatctacctgaccgaacaacaggcactggcggagcgttttaatgac
gtaccgctgtggatccgtccgcaaagtttcttccagactaatccggcggtcgccagccag
ttgtacgccaccgcgcgcgactgggtacgacagctgccggttaaacatatgtgggatctg
ttctgcggtgtggggggctttggtttacactgcgcgacgcctgacatgcagttaaccggg
atcgaaattgcatcagaggccattgcctgtgcaaagcagtcagccgctgaactgggctta
acgcgtttgcaatttcaggcgctggactccactcagtttgccaccgctcagggggatgtg
ccggagctggtgctggttaacccgccgcgccgcggcattggtaaaccgctgtgtgattat
ctctcaacgatggcaccgcgttttatcatctactccagctgtaacgcccaaactatggcg
aaagatatccgcgaactgcctgggtttcgtattgaacgggtgcagcttttcgatatgttc
ccgcataccgcgcactatgaagtgctgacgctgctggtgaagcaataa
              
                            

Download fasta file
RegulonDB