RegulonDB RegulonDB 10.9: Gene Sequence
amiD gene sequence


Size: 831        A: 194  T: 171  G: 249  C: 217

Fasta

 

>amiD E. coli K12. Version NC_000913.3 GI:556503834
atgagaagattcttctggctggtcgctgccgctctgttattggcagggtgtgcaggcgaa
aaaggcattgtcgagaaagagggatatcagcttgatacccgacgccaggcgcaggcggcg
tatccgcgcattaaagtgctggtgatccactacaccgcagatgattttgatagctcgctg
gcgacactgaccgataagcaggtcagctcgcattatctggtccctgcggtaccaccgcga
tacaacggtaaaccgcgcatctggcaactggtgccggaacaagaactggcctggcatgcg
gggattagcgcctggcgcggggcaacgcgccttaacgacacctctattggcattgagctg
gaaaaccgtggctggcaaaaatcggccggagtgaaatattttgccccgtttgaaccggca
cagattcaggcgcttattccactggcgaaagatattattgcccgttatcacatcaagccg
gaaaacgtagtggcacatgcggatatcgcaccgcagcgcaaagacgatccggggccatta
tttccctggcagcaactggcgcagcaggggattggtgcctggccggatgcgcagcgggtt
aacttttaccttgccgggcgcgcgccgcacacaccggtagataccgcgtcattgctggag
cttttggcgcgctacggttatgacgttaaacctgatatgacaccgcgcgagcagcggcgc
gtgattatggcattccagatgcatttccgcccgacgttatataacggcgaagcggatgca
gaaactcaggcgattgccgaagcattgctggagaaatacgggcaggattag
              
                            

Download fasta file
RegulonDB