RegulonDB RegulonDB 10.9: Gene Sequence
ybjS gene sequence


Size: 1014        A: 236  T: 226  G: 269  C: 283

Fasta

 

>ybjS E. coli K12. Version NC_000913.3 GI:556503834
atgaaggtactggttaccggcgccaccagcggcttaggtcgaaacgcggtagagttttta
tgccagaaaggcatcagcgtgcgagcgaccggtcgcaacgaggcaatgggcaaattgctg
gaaaaaatgggcgcagagtttgttccggcggatctgaccgagctggtttcatcacaagct
aaagtgatgctcgcgggcattgatacgctgtggcactgctccagctttacctcaccctgg
gggacacaacaggctttcgatctggctaacgttcgcgccactcgccgcctgggtgaatgg
gctgtcgcctggggtgtgcgtaactttattcatatctcttccccctccctgtacttcgat
tatcaccaccatcgcgatattaaagaagattttcgccctcaccgcttcgccaacgagttt
gcccgcagcaaagcagccagcgaagaagtgatcaatatgctttcgcaggcgaatccacaa
acgcgctttactattctgcgcccacaaagtctgttcggaccgcacgataaagtctttatt
ccccgtctggcgcatatgatgcaccactacggcagtattctgttaccgcatggcggcagt
gcgctggtcgatatgacctactatgaaaatgccgtgcacgcaatgtggctggcaagccag
gaagcctgcgataagctaccttccgggcgtgtgtacaacatcaccaacggcgagcatcgc
acactgcgcagcatcgtgcagaagctgatcgacgagttgaatattgactgtcgtattcgt
tccgtcccctacccgatgctggatatgatcgcccgcagcatggagcgtttaggccgcaag
tcagcaaaagagccgccgctgacccactacggcgtctccaagttgaattttgactttacg
ctggatattacgcgtgcgcaggaagagttaggttatcagccggtcatcaccctggatgaa
ggtatcgagaaaactgccgcctggctacgcgaccacggaaaactgccgcgctaa
              
                            

Download fasta file
RegulonDB