RegulonDB RegulonDB 10.9: Gene Sequence
ybjT gene sequence


Size: 1431        A: 309  T: 335  G: 407  C: 380

Fasta

 

>ybjT E. coli K12. Version NC_000913.3 GI:556503834
gtgccgcaacgcattttagttctcggtgccagtggctacattggtcagcatctggtgcgc
acactcagccagcaagggcatcagatcctggcggcggcacgtcatgtcgacaggcttgca
aagctgcaactggcaaacgtcagttgccataaagtcgatctcagctggccggataaccta
ccggccctgttgcaggatatcgatacggtctattttctggtgcacagcatgggcgaaggc
ggcgattttatcgctcaggagcgccaggtggctctcaacgtccgcgatgcgctacgtgaa
gtaccagttaagcaattaatctttcttagttcgttgcaggccccgccacatgagcagtcg
gatcatctgcgtgctcgtcaggctacggcggacattctgcgtgaagcgaatgtacccgtg
accgaactgcgggccggaattatcgttggcgcaggttccgcggcgttcgaagtcatgcgc
gatatggtctacaacctgccagtcttaacgcctccgcgctgggttcgttcacgcaccacg
cccattgcgctggaaaacttgctgcactatctggttgcgttgttagatcatccggccagc
gaacaccgcatcttcgaagccgccggaccagaggtgctcagttatcagcaacagtttgaa
cattttatggcggtgagcggtaagcgccgctggttgatccccatccccctccccacccgc
tggatttcggtgtggtttctcaatgtgattacttccgtaccgcccaccaccgccagggcg
ttgattcaggggctgaaacacgatctgctggcggatgataccgcgctacgtgcactcatc
ccacaacggctgatcgctttcgatgacgcggtacgtagcacgttgaaagaggaggaaaaa
ctggtcaactccagcgactggggctacgacgctcaggcctttgcccgctggcgaccggag
tacggttattttgccaaacaggcggggtttaccgttaaaacgtccgccagccttgctgct
ttatggcaggtagtgaaccaaatcggcggtaaagagcgttatttctttggcaatattttg
tggcagacacgggcgttgatggaccgcgcgatcggtcataagctggcgaaaggccgcccg
gagcgcgaatatttacagactggcgatgcggtggatagctggaaagtgattgtcgttgaa
ccggaaaaacaacttacgttgttatttggcatgaaagcgccggggctgggacgactgtgt
tttagcctggaagataaaggcgactatcgtactatcgatgtccgcgctttctggcatccg
cacggtatgccggggctgttttactggttattgatgatccccgcgcatctgtttattttt
cgcggaatggcaaaacaaatcgccagactggcagaacaaagcacagattaa
              
                            

Download fasta file
RegulonDB