RegulonDB RegulonDB 10.9: Gene Sequence
ltaE gene sequence


Size: 1002        A: 230  T: 209  G: 291  C: 272

Fasta

 

>ltaE E. coli K12. Version NC_000913.3 GI:556503834
atgattgatttacgcagtgataccgttacccgaccaagccgcgccatgctcgaagcgatg
atggccgccccggttggggacgacgtttacggagacgaccctaccgttaatgctctgcag
gactacgcagcagagctttccggtaaagaagccgccatttttctgcctaccggcactcag
gccaacctggtcgctctgctcagtcactgcgaacgcggcgaagagtatattgtcggtcag
gccgcgcataactatctgtttgaagccggtggcgcggcggtgctgggcagtattcaaccg
caacccatagacgcggctgccgacggcacgctaccgctggataaagtggcgatgaaaatc
aaacccgacgatatccatttcgcccgcaccaaattactcagtctggaaaacacccacaac
ggcaaagtgttgccgcgggaatacctgaaagaagcatgggaatttacccgcgagcgcaat
ctggcgctgcatgttgacggtgcgcgcatctttaatgccgtggtggcttacggctgcgaa
ctgaaagagatcacgcaatattgtgattcgttcaccatttgcctgtcgaaaggtcttggg
acgccagtcggttcattactcgtcggtaatcgtgattacattaaacgtgccattcgctgg
cggaaaatgacaggtggcgggatgcgccagtccggcattctggctgccgccgggatatat
gccctgaaaaataacgttgcgcgcttgcaggaagaccacgacaacgctgcctggatggcg
gagcagctgcgtgaagcaggcgcggatgtgatgcgtcaggacaccaatatgctgtttgtt
cgcgtcggggaagaaaatgctgccgcgttaggcgaatacatgaaagcgagaaacgtgctg
attaacgcctcgccgattgtccgcctggtgacgcatcttgacgtctcgcgcgaacaactg
gcggaagtcgccgcccactggcgtgcattcctggcgcgttaa
              
                            

Download fasta file
RegulonDB