RegulonDB RegulonDB 11.0: Gene Sequence
hcr gene sequence


Size: 969        A: 216  T: 216  G: 285  C: 252

Fasta

 

>hcr E. coli K12. Version NC_000913.3 GI:556503834
atgacgatgccaacgaatcaatgcccgtggcggatgcaggttcatcacattacgcaagaa
acgccggatgtgtggacgatttccctgatttgccacgattactacccatatcgcgccggg
caatatgcactggtcagcgtgcgaaactcagcggaaacgctgcgtgcttacaccatttcc
tccacgccaggcgtgagtgaatatatcaccctgaccgtgcggcggattgatgacggtgtc
ggctcccagtggctgacgcgcgatgtaaaacgcggtgattatctctggctttcggacgcg
atgggggaatttacctgcgacgataaagcagaagataaattcctgttgctggcggcaggc
tgcggcgtcacgccgattatgtcgatgcgtcgctggcttgcgaagaaccgtccacaggcc
gatgtgcgggtgatctacaacgtgcgtacgccgcaggatgttattttcgccgatgagtgg
cgtaactatccggtaacgctggtggcagaaaataacgttaccgaaggctttatcgctggt
cgtctcactcgcgaactgctggcaggtgtacctgacttagcttcacgtaccgtgatgacc
tgcggcccggctccgtatatggattgggtagagcaggaagtgaaagcgctcggcgtgacg
cgtttctttaaagagaaattcttcaccccagtagcagaagcggcgaccagcggtctgaaa
ttcaccaaactgcaaccggcacgagaattttacgccccggttggcaccacgctactggag
gcgctggaaagcaataacgttccggttgtcgctgcctgccgtgcgggtgtttgcggctgc
tgtaagacaaaagtggtttccggtgaatatacggtgagcagcacaatgacgctgaccgac
gccgaaatcgctgaaggttacgtactggcctgctcctgccatccgcagggggatttggtt
ctcgcataa
              
                            

Download fasta file
RegulonDB