RegulonDB RegulonDB 10.9: Gene Sequence
lysO gene sequence


Size: 900        A: 167  T: 299  G: 219  C: 215

Fasta

 

>lysO E. coli K12. Version NC_000913.3 GI:556503834
atgttttctgggctgttaatcattctggttcccctgattgtgggttacctcattccgctt
cgccaacaagctgcgttaaaagttattaatcagctattaagctggatggtttaccttatt
ctcttttttatgggtatcagtctggcgtttctcgataacctcgccagtaacctgttggcg
attctgcattattctgccgtcagtattaccgttattttactgtgtaatattgccgccctg
atgtggctggagcgaggcctgccgtggcgcaaccaccatcagcaagaaaaactcccgtcg
cgtattgcgatggcgctggagtcgctaaaactgtgcggcgtagtagtgattggttttgcc
attggtctaagtggactggctttcttacaacacgcgaccgaagccagtgaatacacgtta
attttgctacttttcctcgttggtattcagttgcgcaataatggcatgaccttaaagcag
attgtccttaatcgccggggaatgattgtcgccgtggtggtggttgtcagttcattaatt
ggtggtttaattaacgcctttattcttgatctccccatcaataccgcgctggcaatggcc
tccggtttcggctggtattctctttccggtattttattgaccgaatcttttggtccggta
atcgggagcgcggcgttttttaatgatctggcccgtgaactgattgctattatgttgatc
cctgggctgattcgccgcagccgctctactgcactgggcttatgcggtgccacatcaatg
gatttcaccctgcccgttcttcaacgtactggcgggctggatatggtcccggcggcaatt
gttcacggttttattcttagcctgttagtgccgatcctcatcgcctttttctctgcgtaa
              
                            

Download fasta file
RegulonDB