RegulonDB RegulonDB 10.9: Gene Sequence
ybjD gene sequence


Size: 1659        A: 361  T: 417  G: 469  C: 412

Fasta

 

>ybjD E. coli K12. Version NC_000913.3 GI:556503834
atgattcttgagcgcgttgaaattgtgggttttcgcggtatcaaccgtttgtcgttgatg
ctggaacaaaacaacgtcctgattggggagaacgcgtggggtaaatccagcttgctggac
gccttaactctgctgctatcgccagaatcagatctctaccattttgagcgcgacgatttc
tggttcccgccgggagatatcaacgggcgagaacatcatctgcatattattttgaccttc
cgcgaatcgctgccaggccgacatcgggttcgccgttatcggccgctggaagcgtgctgg
acgccatgcaccgatggctatcaccgtattttttatcgtctggaaggggagagtgcggaa
gacggcagcgtgatgacactgcgcagttttctcgataaagacggacatccgattgatgtc
gaggatattaacgatcaggcacgccatctggtgcgtttaatgccggtgctgcgcttgcgt
gatgcccgttttatgcgccgtattcgtaacggcacggtgccaaatgtccctaatgtggaa
gtcaccgcgcgccagctcgatttcctcgcccgtgagttatcctcacatccgcaaaatctc
tctgatgggcagattcgtcagggactttccgcaatggtacagctgcttgagcattatttc
tctgagcagggggccggacaggcgcgatatcgtttaatgcggcggcgagccagcaatgag
caacgaagctggcgctatctggatatcatcaaccggatgattgaccgacctggtgggcgc
tcgtatcgggttattttgctcggcctatttgctactttgttgcaggcaaaaggcacattg
cgactggataaagacgcccgtccattgttgctgatcgaagatccagaaacccgtttacac
cccattatgctttcagttgcctggcatctgttgaatcttctgccattgcagcgcattgcc
accaccaactcgggtgagttgctttcgttaacgccggtagagcatgtttgccgactggta
cgtgagtcctcgcgcgttgccgcctggcgtctggggccgagtggcttgagtaccgaagat
agccgacgcatatcctttcacattcgttttaaccgtccgtcatcgctgtttgcacgctgc
tggttgctggtggaaggggaaacggaaacctgggttatcaatgaactggcgcgtcagtgc
ggacatcattttgatgccgaagggatcaaggtcattgagtttgcccagtccgggctaaag
ccactggttaaatttgcccgccgaatggggattgaatggcatgtactggtcgatggcgat
gaagcagggaagaaatatgccgctacggtacgcagcctgttgaataacgatcgggaagcc
gaacgagaacatttaacggcgttaccggcgctggatatggaacattttatgtatcgccag
ggattttccgatgtgttccaccgcatggcgcaaatcccggaaaatgtaccgatgaatcta
cgcaaaattatctcgaaagcgatccatcgctcttccaaacccgatcttgccattgaagtg
gcaatggaggcaggacgtcgtggtgtggactccgtaccgacgctgctgaaaaaaatgttc
tcacgcgtgctgtggctggcgcgcggtcgcgcggattaa
              
                            

Download fasta file
RegulonDB