RegulonDB RegulonDB 10.9: Gene Sequence
macB gene sequence


Size: 1947        A: 411  T: 486  G: 584  C: 466

Fasta

 

>macB E. coli K12. Version NC_000913.3 GI:556503834
atgacgcctttgctcgaattaaaggatattcgtcgcagctatcctgccggtgatgagcag
gttgaggtgctgaagggcatcagcctcgatatttatgcgggtgagatggtcgcgattgtt
ggcgcttcgggttccggtaaatcgaccctgatgaatattctcggctgtctggataaggcc
accagcggcacctatcgcgtcgccggtcaggatgttgccacgctggacgccgatgcgctg
gcgcaactgcgccgcgagcatttcggctttattttccagcgttaccatttgctttcgcat
ttaaccgccgagcagaacgttgaagtacccgccgtctatgctggtcttgagcggaaacag
cgactgcttcgtgcccaggagttgctgcaacggctggggctggaagaccgtacagagtat
tatccggcacagctttcgggtggtcagcaacagcgcgtcagcatcgcgcgggcattgatg
aacggtggtcaggtaattcttgccgatgaaccaaccggcgcactggacagccattctggc
gaagaggtgatggcgatcctgcatcagctgcgcgatcgtgggcatacggtgattatcgtc
acccacgatccgcaggtcgctgctcaggccgagcgggtgatcgaaattcgcgacggcgaa
attgtgcgcaatcctcccgccattgaaaaagtgaatgttactggcgggacggaacctgtt
gtcaacacggtgtctggctggcggcagtttgtcagcggttttaacgaggcgctgacgatg
gcatggcgggcgctggcagcgaataaaatgcgtactttactgaccatgctggggattatt
atcggtattgcgtcggtggtttccattgtcgtggtgggtgacgccgccaaacaaatggtg
ctggcggatattcgttctattggtacgaatactattgatgtctatcccgggaaagatttt
ggcgatgacgatccgcaatatcagcaggcgctgaagtacgacgacttaatcgccatccaa
aaacaaccgtgggtcgcctcagccacacctgccgtctcgcaaaacctgcgcctgcgttat
aacaatgttgatgttgctgccagtgccaatggcgtgagcggcgattattttaatgtctat
ggcatgaccttcagtgaaggaaacacctttaatcaggagcagctgaacggtcgtgcgcag
gtcgtggttctcgacagtaatactcgccgccagcttttcccccataaagcagatgtggtt
ggcgaggtgattctggtcggcaatatgcccgccagagtcattggtgtggcggaagaaaaa
cagtcgatgtttggtagcagtaaagtgctgcgtgtctggctaccttacagcacgatgtcc
gggcgagttatgggccagtcgtggcttaactccattactgtcagggtgaaagaaggattt
gacagcgccgaggcggaacagcaactcacgcgtttactttcactgcgccacggaaagaag
gatttctttacctggaacatggacggcgtcttgaaaactgttgaaaagaccacacgtact
ttacaactgtttctgacgctggtggcggtgatttcgctggtggtgggcggtattggtgta
atgaatattatgctggtgtcagtgaccgagcggacgcgggaaattggcattcgcatggct
gtaggtgcgcgagcaagcgatgttttgcaacagttcctgatcgaagccgtactggtttgc
ctggtcggtggcgcgttgggaataacactgtcactgttaattgctttcaccttgcagctt
ttcttacccggctgggagattggtttttcaccgttggcgctgctgctggcgtttctctgc
tcgacggtcaccgggattttatttggctggttacccgcacgaaatgcggcacgactggat
ccagtagatgctctggcacgagagtaa
              
                            

Download fasta file
RegulonDB