RegulonDB RegulonDB 10.9: Gene Sequence
ftsK gene sequence


Size: 3990        A: 944  T: 891  G: 1095  C: 1060

Fasta

 

>ftsK E. coli K12. Version NC_000913.3 GI:556503834
ttgagccaggaatacattgaagacaaagaagtcacattgacaaagttaagtagcggccgc
cgccttctggaggcgttgctgatccttattgtcctgtttgccgtctggttgatggctgcc
ttactaagctttaacccttcggaccccagctggtcgcaaacggcctggcatgaacctatc
cataatttaggtgggatgcccggtgcgtggttggcagatacgctgttctttatttttggc
gtgatggcttacaccattcccgtcattattgtcggcggttgttggtttgcctggcgtcat
cagtccagcgacgaatacattgattattttgccgtttcgctacgcatcattggcgttttg
gcgctcatccttacctcctgtggtctggcggcaatcaacgctgacgatatctggtatttt
gcctccggtggcgtcattggcagcttactaagcactacgctacaaccactgctacacagt
agcgggggaactattgcgctgctctgcgtttgggcagcgggcctgacgttgttcaccggt
tggtcatgggtgaccattgctgaaaaactcggcggctggattttaaacattctcaccttc
gccagtaatcgtacccgtcgcgatgatacctgggtcgatgaagatgagtatgaagacgac
gaagagtatgaagatgaaaatcacggcaaacagcatgaatcacgccgtgcccgtattctt
cgcggcgcgctagcgcgtcgtaaacggttggcggaaaaattcattaatccgatggggcgg
caaacagacgctgcgttgttctccggtaagcggatggatgatgacgaagagattacctac
actgcacgcggtgtggctgccgacccggacgacgtcctattttcgggcaatcgtgcaacg
cagccagaatatgacgaatacgatccattattaaacggtgcgccaattaccgaacctgtc
gctgtagcagctgctgctaccacggcgacacaaagctgggctgcgccggttgaacctgtg
actcagacgccgcctgttgcctctgttgatgttccacctgcgcaacctacagtagcctgg
cagcctgtaccgggtccacaaacgggagagccggttattgctcctgcaccggaaggttac
ccacagcagtcacaatatgcgcagcctgcagtgcaatataatgagccgctgcaacaacca
gtacagccgcagcagccgtattatgcacctgcagctgaacaacctgcgcaacagccgtat
tatgcccctgcgccagaacaaccggtggcaggtaacgcctggcaagccgaagagcagcaa
tccacttttgctccacagtctacataccagactgagcaaacttatcagcagccagccgct
caggagccgttgtaccaacagccgcaacccgttgaacagcagcctgttgtggagcctgaa
cccgttgtagaagagacaaaacccgcgcgtccgccgctttactactttgaagaagttgaa
gagaagcgagcccgtgaacgtgaacaacttgcggcctggtatcaaccgattccagaaccg
gttaaagaaccagaaccgatcaaatcttcgctgaaagcaccttctgttgcagcagtacct
ccagtagaagccgctgccgctgtttccccgctggcatctggcgtgaaaaaagcgacactg
gcgacgggggctgccgcaaccgttgccgcgccagtcttcagtctggcaaatagcggtgga
ccgcgtcctcaggtcaaagaggggattggtccgcagttgccacgaccgaaacgtatccgc
gtgccaactcgtcgtgaactggcgtcttacggtattaagctgccctcacagcgtgcggcg
gaagaaaaagcccgtgaagcccagcgcaatcagtacgattctggcgatcagtacaacgat
gatgaaatcgatgcgatgcagcaggatgaactggcacgtcagttcgcccagacacagcag
caacgctatggcgaacagtatcaacatgatgtgcccgtaaacgcagaagatgcagatgct
gcggcagaggctgaactggctcgtcagtttgcgcaaactcaacaacaacgttattccggc
gaacaaccggctggggcgaatccgttctcgctggatgattttgaattttcgccaatgaaa
gcgttgctggatgatggtccacacgaaccgttgtttacgccaattgttgaacctgtacag
cagccgcaacaaccggttgcaccgcagcagcaatatcagcagccgcaacaaccagttccg
ccgcagccgcagtatcagcagccacaacagccggttgcgccgcagccacaatatcagcag
ccgcaacaaccggttgcgccacagcagcaatatcagcagccgcaacaaccggttgcgccg
cagcagcagtatcagcagccacaacagccagttgcgccacaaccgcaggataccctgctt
catccgctgttgatgcgtaatggcgacagccgtccgttgcataaaccgacgacgccgctg
ccttctctggatttgctgacaccgccgccgagcgaagtggagccggtagatacctttgcg
cttgaacaaatggctcgcctggtggaagcgcgtctggctgatttccgtattaaagccgat
gtcgtcaattactctccggggccggttatcactcgctttgaattgaacctggcaccgggc
gtaaaagcggcgcgcatttctaacttgtcacgggaccttgcccgttcactttcgacggtg
gcggtgcgtgtcgttgaagttattcctggcaaaccctatgtaggtctggagttaccgaat
aaaaaacgacaaaccgtttatctgcgcgaagttttggataacgccaaattccgcgataat
ccgtcgccattaaccgtggtgctgggtaaagatatcgccggtgagccggtggttgccgat
ctggcgaaaatgccgcacttgttggttgcggggactaccggttccggtaaatctgtcggt
gtgaacgcgatgatcctgagcatgctttataaagcacagccagaagatgtgcgtttcatc
atgatcgacccgaaaatgctggagctttcggtttatgaaggcattccgcatctgttaacg
gaagtcgttactgatatgaaagatgccgccaacgcgctgcgctggtgtgttaacgagatg
gagcgtcggtataaactgatgtctgcgctgggtgtgcgtaatctggcgggttataacgaa
aaaattgctgaagccgatcgcatgatgcgtccgattccagacccgtactggaagccgggt
gacagtatggatgcccagcatccggtgctgaaaaaagaaccatacattgtggtgttggtt
gacgaatttgccgacctgatgatgacggtaggtaaaaaagtggaagagctgatagcacgt
ctggcgcaaaaagcccgtgccgcgggtatccacctcgtactggcaactcagcgtccatcg
gttgatgttattactggtctgattaaagcgaatattccgacccgtatcgcctttaccgta
tccagtaagattgactcacgtaccattcttgatcaggctggcgcggaatcactgctgggt
atgggggatatgctctactctgggccgaactccacgttgccggtacgtgtccatggtgct
tttgttcgcgatcaggaagttcatgccgtggtgcaggactggaaagcgcgtggtcgccca
cagtatgttgatggcatcacctccgacagcgaaagcgaaggtggtgcgggtggtttcgat
ggcgctgaagaactggatccgttgttcgatcaggcggtgcagtttgtcactgaaaaacgc
aaagcgtcaatttctggcgtacagcgtcagttccgcattggttataaccgtgcagcgcgt
attatcgaacagatggaagcgcaggggattgtcagcgaacaggggcacaacggtaatcgt
gaagtgctggccccaccgccgtttgactaa
              
                            

Download fasta file
RegulonDB