RegulonDB RegulonDB 11.0: Gene Sequence
ycaN gene sequence


Size: 909        A: 233  T: 252  G: 215  C: 209

Fasta

 

>ycaN E. coli K12. Version NC_000913.3 GI:556503834
atgcggatgaatatgtctgactttgccactttctttgccgtggcccgtaatcaaagcttt
cgtgcagcgggcgatgagttaggcttatcctcgtccgccattagccatagtattaaaaca
ctggaacaacgtcttaaaattcgcttattcaatcggacaacccgaagcgtatcgttaacg
gaagcgggttctaatctctatgaacgattgcgcccagctttcgacgaaattcagatcatg
ttagatgagatgaatgattttcgtctgacaccgacaggaacgctcaaaatcaatgccgcc
cgggtagctgcacgtatatttttaatgtctttactggttggtttcacacgtgaatatcct
gatattaaagtcgagctcacaactgacgactctcttgtcgatatcgtccaacagggcttt
gacgctggcgttcgacttagttgcatcgtcgaaaaagatatgatcagcgtggcgatcggc
ccgccagtgaaattatgtgtagcagcaacgccagagtactttgcaagatatggcaaaccc
cgccatcctcatgatctgcttaatcatcaatgtgttgtttttcgttatcccagcggcaaa
cctttccactggcaatttgcaaaggagctggaaattgctgtcgcaggaaatatcattctg
gatgatgttgatgctgaactggaggccgttttgatgggtgctggtatcgggtatctgctc
tatgaacagatcaaggagtaccttgatactggtcgtttagaatgtgtactggaagactgg
agcacagagcgtccaggcttccagatctattatccaaaccgccagtatatgtcctgcggc
ttgcgcgcatttctcgattatgtaaaaacgggtcagatctgccagagtcagcgtcaccga
ccacaataa
              
                            

Download fasta file
RegulonDB