RegulonDB RegulonDB 10.9: Gene Sequence
ycaP gene sequence


Size: 693        A: 166  T: 197  G: 196  C: 134

Fasta

 

>ycaP E. coli K12. Version NC_000913.3 GI:556503834
atgaaggcgttcgatctccaccgtatggcatttgataaagtgccttttgatttccttggc
gaagttgcactacgtagtctttatacctttgtactggtctttttgttcctcaaaatgacc
ggaagacgcggtgtgcggcagatgtcgctgtttgaagttttaatcattctgacgctggga
tcagcggcgggagatgtggcgttttatgatgatgtgccgatggtcccggtacttatcgtc
tttattactctggcgttgttataccgcctggtaatgtggttgatggcgcacagtgaaaaa
ctggaagatcttctggaaggcaagccagttgtcattattgaagatggcgagctggcctgg
tcgaaactcaataactccaacatgacggaatttgagttctttatggagctacgattgcgt
ggcgtggagcagctggggcaggtacgtctggcgattctcgaaaccaacgggcaaatcagt
gtctatttctttgaagatgacaaggtgaaaccgggtttacttattttacccagtgattgt
acgcagcgttacaaagtggtgccggagtcggcggactatgcctgtattcgttgtagtgaa
atcattcatatgaaagcgggggaaaaacaattatgtccgcgctgtgcaaatccagaatgg
acgaaggcaagtcgggcaaaacgggtgacctga
              
                            

Download fasta file
RegulonDB