RegulonDB RegulonDB 10.9: Gene Sequence
ycaL gene sequence


Size: 765        A: 208  T: 175  G: 195  C: 187

Fasta

 

>ycaL E. coli K12. Version NC_000913.3 GI:556503834
atgaagaatactaaattactgctggcgattgcgacctctgcagcattactgacagggtgt
caaaatacccacggtattgataccaatatggctatcagctccggtttaaatgcctataaa
gcagcaacattaagcgatgccgatgcaaaagcgattgccaatcagggctgtgccgaaatg
gacagcggcaatcaagtcgcaagtaaatccagcaagtacggtaaacgtctggcaaaaatc
gccaaagcattgggtaacaatattaatggcacgccggtcaactataaggtttatatgacc
agcgacgtcaacgcatgggcgatggcgaacggctgtgttcgtgtctacagtggcctgatg
gacatgatgaatgacaacgaaattgaaggcgttctgggccatgaactgggccacgtcgcg
ttgggtcactcgctggctgaaatgaaagcttcttatgcgatcgttgccgcacgcgatgcc
atttcagctaccagcggtgtggcttcccagctttcccgctcacaattaggtgatatcgca
gaaggcgctatcaatgctaaatactcccgtgataaagagtccgaagcagatgatttctcc
tttgatctgttgaagaaacgtggcatcagcacccaggggctggttggcagctttgaaaca
ctggctagcctggatggcggtcgcacccagtccatgtttgactctcacccaccatcaaca
gagcgtgcgcaacacatccgtgatcgtatcgcctctggtaagtaa
              
                            

Download fasta file
RegulonDB