RegulonDB RegulonDB 10.9: Gene Sequence
ycaQ gene sequence


Size: 1233        A: 291  T: 297  G: 339  C: 306

Fasta

 

>ycaQ E. coli K12. Version NC_000913.3 GI:556503834
atgtcgctgccgcacctctcccttgctgatgcgcgtaatcttcaccttgccgcacaaggc
ctgttaaacaaaccccgccgtcgagcgtcgttggaggatattccggcaacgatctcccgc
atgtccttgctgcaaatcgataccatcaatattgttgcccgtagtccatatctggtgctt
ttcagtcgtctgggaaattatcctgcccagtggctggatgagtctctggcgcgtggcgaa
ttaatggaatactgggcgcatgaagcctgctttatgccgcgtagcgactttcgtcttatt
cgccaccgcatgctggcacctgaaaaaatgggctggaaatacaaagacgcctggatgcag
gaacatgaggcggaaattgcacagttaattcagcatattcatgataaggggccggtacgt
tcagccgattttgagcatcctcgtaaaggtgcaagcggctggtgggaatggaagccgcat
aaacggcatctggaaggtttatttactgccggaaaggtgatggtgattgaacggcgcaac
ttccagcgcgtttatgatttaacccaccgtgtcatgcctgactgggatgatgagcgcgat
ctcgtttcgcaaacagaagcagaaatcatcatgctggataacagtgcgcgtagcctggga
atattccgcgaacagtggctggcagattactatcggctgaaacgtccggcactggcggcg
tggcgcgaagcgagggctgaacagcagcaaatcattgctgtgcatgttgaaaaattgggc
aatctttggctgcatgatgatttgctgccgctactcgagcgagcgctggccggaaagctc
actgcaacgcacagcgcggtactttcgccttttgatcctgttgtctgggatcgcaaacgc
gcagagcagctttttgattttagctaccggctggagtgctataccccagcgccgaaacgc
cagtatggctattttgttctgccgttattacatcgtgggcaattagttgggcgaatggat
gccaaaatgcatcgccagacaggcatccttgaagttatctctctgtggttacaggaaggt
attaaaccaacgacaacgctgcaaaaagggctacgtcaggcgattactgatttcgctaac
tggcagcaggcaacgcgggtgacattaggatgctgcccgcaaggcctctttactgattgc
cgcaccggctgggaaatagaccccgtcgcataa
              
                            

Download fasta file
RegulonDB