RegulonDB RegulonDB 10.9: Gene Sequence
mepK gene sequence


Size: 549        A: 143  T: 133  G: 131  C: 142

Fasta

 

>ycbK E. coli K12. Version NC_000913.3 GI:556503834
atggacaaattcgacgctaatcgccgcaaattgctggcgcttggtggcgttgcactcggt
gccgccatcctgccgacccctgcgtttgcaacactctctaccccacgcccgcgcattttg
acactcaataatcttcataccggagagtcaatcaaagcggagtttttcgatggcagaggc
tatattcaggaagaattggcaaaacttaaccattttttccgcgattaccgcgcgaacaaa
ataaagtccatcgacccaggattattcgaccagttgtatcgcctgcaagggttgttaggc
acgcgcaaaccggtgcaactcatttccggttatcgttctattgataccaacaatgaacta
cgcgcccgcagccgtggagtagcgaagaaaagctatcacactaaaggccaggcgatggat
ttccatattgaaggtatcgcgttaagcaatattcgcaaagccgcgttatctatgcgcgca
ggtggtgtaggatattatccacgtagtaactttgtgcatattgataccgggccagcacgg
cactggtag
              
                            

Download fasta file
RegulonDB