RegulonDB RegulonDB 10.10: Gene Sequence
ssuC gene sequence


Size: 792        A: 130  T: 220  G: 249  C: 193

Fasta

 

>ssuC E. coli K12. Version NC_000913.3 GI:556503834
atggcaacgccagtgaagaagtggttattgcgcgttgccccctggtttttaccggtgggc
atcgtggcggtgtggcaactggcctcctcggttggctggctgtcgacgcgtattttgcct
tcaccggaaggagtggtgacggcgttctggacgctctccgccagcggcgaactgtggcag
catctggcgatcagctcctggcgggcgctgattggcttttcaattggcggatcgctgggg
ttgattttgggactgattagcgggctatctcgctggggagaacggctgctggatacctca
attcagatgttgcgcaacgtgccgcatctggcgctgatcccgctggtgattttgtggttt
ggcattgatgaatccgcaaaaatctttctggtggcgctcggtacgctattccccatttat
atcaacacctggcatggcatccgtaatatcgatcgcgggttggtggagatggcgcgtagc
tatggattatccggcataccgctgtttatccatgtgatcctgcctggtgccctgccctca
attatggtcggcgtgcgttttgcgttgggcctgatgtggctgacgctgattgttgccgaa
accatttctgccaattcaggcattggttatctggcgatgaatgcgcgggagtttttgcaa
acggacgtggtggtagtcgctattattctttacgccctgctcggcaaactggctgacgtc
agcgcgcagctgttagagcgcctctggttgcgctggaacccggcttatcatttgaaggag
gccacggtatga
              
                            

Download fasta file
RegulonDB