RegulonDB RegulonDB 10.9: Gene Sequence
ssuD gene sequence


Size: 1146        A: 244  T: 249  G: 342  C: 311

Fasta

 

>ssuD E. coli K12. Version NC_000913.3 GI:556503834
atgagtctgaatatgttctggtttttaccgacccacggtgacgggcattatctgggaacg
gaagaaggttcacgcccggttgatcacggttatctgcaacaaattgcgcaagcggcggat
cgtcttggctataccggtgtgctaattccaacggggcgctcctgcgaagatgcgtggctg
gttgccgcatcgatgatcccggtgacgcagcggctgaagtttcttgtcgccctgcgtccc
agcgtaacctcacctaccgttgccgcccgccaggccgccacgcttgaccgtctctcaaat
ggacgtgcgttgtttaacctggtcacaggcagcgatccacaagagctggcaggcgacgga
gtgttccttgatcatagcgagcgctacgaagcctcggcggaatttacccaggtctggcgg
cgtttattgcagagagaaaccgtcgatttcaacggtaaacatattcatgtgcgcggagca
aaactgctcttcccggcgattcaacagccgtatccgccactttactttggcggatcgtca
gatgtcgcccaggagctggcggcagaacaggttgatctctacctcacctggggcgaaccg
ccggaactggttaaagagaaaatcgaacaagtgcgggcgaaagctgccgcgcatggacgc
aaaattcgtttcggtattcgtctgcatgtgattgttcgtgaaactaacgacgaagcgtgg
caggccgccgagcggttaatctcgcatcttgatgatgaaactatcgccaaagcacaggcc
gcattcgcccggacggattccgtagggcaacagcgaatggcggcgttacataacggcaag
cgcgacaatctggagatcagccccaatttatgggcgggcgttggcttagtgcgcggcggt
gccgggacggcgctggtgggcgatggtcctacggtcgctgcgcgaatcaacgaatatgcc
gcgcttggcatcgacagttttgtgctttcgggctatccgcatctggaagaagcgtatcgg
gttggcgagttgctgttcccgcttctggatgtcgccatcccggaaattccccagccgcag
ccgctgaatccgcaaggcgaagcggtggcgaatgattttatcccccgtaaagtcgcgcaa
agctaa
              
                            

Download fasta file
RegulonDB