RegulonDB RegulonDB 10.9: Gene Sequence
ssuE gene sequence


Size: 576        A: 125  T: 139  G: 144  C: 168

Fasta

 

>ssuE E. coli K12. Version NC_000913.3 GI:556503834
atgcgtgtcatcaccctggcgggtagtcctcgctttccttctcgctccagctccttgctg
gaatatgcgcgggaaaaactaaatggcctggatgtagaggtttatcactggaatctgcaa
aacttcgccccggaagatctactttatgctcgtttcgatagtccggcactcaagaccttc
accgaacagctgcaacaggccgatgggctgattgtcgccacgcctgtgtataaagccgcc
tattccggtgcgttgaaaaccctgctcgacctgctgccagaacgcgctttgcaaggcaaa
gtggtgctaccgctggcgacgggcggtaccgtggcccatctgctggcggtcgattatgcc
cttaaaccagttttaagcgcactgaaagctcaggagatcctgcacggcgtgtttgccgat
gactcacaagtaattgattaccatcacagaccccagttcacgccaaatctgcaaacccgt
cttgataccgcgctagaaactttctggcaggcattgcaccgccgcgatgttcaggttcct
gaccttctgtctctgcgaggtaatgcccatgcgtaa
              
                            

Download fasta file
RegulonDB