RegulonDB RegulonDB 10.9: Gene Sequence
elfA gene sequence


Size: 540        A: 161  T: 150  G: 126  C: 103

Fasta

 

>elfA E. coli K12. Version NC_000913.3 GI:556503834
atgaaaaaaagtgtattgacggcgtttataactgtggtatgtgcaacgtccagcgttatg
gctgctgatgataatgctatcacggatggctcagtaacatttaatggtaaagttattgct
ccagcttgtaccctggtagctgcgacgaaagattccgtggtgactttgccagatgttagt
gccacgaagttgcaaaccaatggtcaggtttctggcgtgcaaattgatgtgccaattgaa
ttaaaagattgtgatactaccgtaacaaaaaatgcaacgttcacctttaatggcactgcg
gatactactcagattacagcgtttgctaaccaggcctcatctgatgctgctacaaacgtg
gccctgcaaatgtatatgaatgatggtacaacggccatcacgccagacacagaaaccggg
aacattttgttgcaggatggagatcagacgttgacttttaaagttgattatatcgctacg
gggaaagcgacttcaggtaatgtgaatgcggtaacaaatttccatattaactattattaa
              
                            

Download fasta file
RegulonDB