RegulonDB RegulonDB 10.9: Gene Sequence
elfG gene sequence


Size: 1071        A: 273  T: 281  G: 279  C: 238

Fasta

 

>elfG E. coli K12. Version NC_000913.3 GI:556503834
atgcagataatctttggagaaaaatgcgtgtcattactacgactattttttgccgccgtc
ttaatgttatggtgcgctcaaaccgctgcttatagcgggcagtgtcatactactcagggg
aatccgtatattggcgtcaattttggcgttaaaaccctggaggaagaagcaaatacggca
ggggtagttaaagacaaattttatcagtggaacgaatcgaatgattattatgtttcctgt
gattgcgataaagacaatgtcagaagtggccgatgggcattcgccgcggattcaccgtta
gtctatttaggcgacaactggtacaaaattaatgactatcttgccgccaaagttttattg
caggttaaaggcagttctcctactgcggttcctttcgaaaacgtgggcacagggggggat
acccgatggcatatttgcgaccctggcggtcaacgtttaggtgggcagggggcaagcggt
aatagcggtagcttttccctgaaaatattgcagccgttcgttggctcggtcgtcattcct
cctatggcgctggcgcgattatatgaatgctacaacatacccgcaggtgattcctgcacg
actacaggtacaccggttttagtgtattacctgtctggtacgatcaattcacttggctca
tgttccgtcaatgccggagagacaattgaagttgatttaggtgatgtcttcgctgccaat
ttccgtgttgtagggcataaacctcttggggccagaacggcagaacttgcaattccagtc
aggtgtaacacgggaaacgcgggattagttaatgtcaacctgagtctgacggcaaccaca
gaccccagctatccccaggcgattaagacgtcacgtcctggcgtgggcgtggtggtgacc
gatagccagaacaacattatttcccctgctggtggaacattaccgctctctattcctgat
gatgcagacagtatcgcgcgaatgaatgtctatccagtcagcacgacaggtgtaccacca
gaaaccgggcgatttgaagccacggcaacggtgagaataaattttgattaa
              
                            

Download fasta file
RegulonDB