RegulonDB RegulonDB 10.10: Gene Sequence
ycbV gene sequence


Size: 516        A: 133  T: 139  G: 139  C: 105

Fasta

 

>ycbV E. coli K12. Version NC_000913.3 GI:556503834
atgttgaaacggataatctggattctgttcttattgggattaacgtggggctgtgagcta
tttgcccatgatggcacggtcaacattagcggatcgtttcgccgtaatacatgcgtgctg
gcacaggatagcaagcaaatcaatgtgcagttaggcgatgtctcgctgacacgtttttct
catgggaattatggcccggagaaatctttcatcattaatttgcaggattgcggaacagat
gtcagcacggttgacgtcaccttttcaggaacccccgacggagtgcagagcgaaatgttg
tccattgaaagtggtacggatgcagccagcgggctggcaattgcgattctggatgatgcg
aagatattgattccgcttaaccaggcgagtaaagactacagcctacatagcggtaaggtg
ccattaactttttatgcgcaattgcgacctgtcaatagcgatgtgcagtcgggtaaagtg
aatgccagcgcgacatttgtacttcattatgactaa
              
                            

Download fasta file
RegulonDB