RegulonDB RegulonDB 10.10: Gene Sequence
zapC gene sequence


Size: 543        A: 133  T: 142  G: 141  C: 127

Fasta

 

>zapC E. coli K12. Version NC_000913.3 GI:556503834
atgcgaattaaaccagacgataactggcgttggtattacgatgaagagcacgatcgaatg
atgctcgatttagccaatggtatgctatttcgctcacgttttgcgcgcaagatgttgact
ccagatgccttttctcccgcaggcttttgcgttgacgacgccgcgctctatttctctttt
gaagaaaagtgccgcgattttaatttatctaaagaacaaaaagccgaactggtgctgaat
gcactggtagcaattcgctatctcaaaccgcaaatgccgaaaagctggcattttgtttcc
catggtgaaatgtgggtgcccatgccgggcgatgcggcctgcgtttggttgagcgatact
cacgagcaggtcaatttgctggtcgttgaatctggcgaaaatgccgcactatgcctgctg
gcacaaccctgcgttgttattgcgggtcgcgcgatgcagttgggcgacgccattaaaatc
atgaacgacaggctgaaaccgcaggttaatgttgacagcttcagcctcgaacaggcagtc
taa
              
                            

Download fasta file
RegulonDB