RegulonDB RegulonDB 10.10: Gene Sequence
uup gene sequence


Size: 1908        A: 499  T: 409  G: 552  C: 448

Fasta

 

>uup E. coli K12. Version NC_000913.3 GI:556503834
atgtcattaatcagtatgcatggcgcatggctgtcgttcagcgacgcgccgcttctcgat
aacgcagaactgcatatcgaagataacgaacgtgtttgtctggtgggccgcaacggcgca
ggcaaatcgacgttaatgaaaatcctcaaccgtgaacaagggctggatgacggtcgcatt
atttacgagcaagatttgattgtagcgcgtctgcaacaggatccgccgcgtaacgttgag
ggtagcgtttatgatttcgttgccgaaggcattgaagaacaagcggaatatctgaaacgc
tatcacgatatttcgcgcctggtgatgaacgacccgagcgagaaaaatctcaacgaactg
gcgaaggttcaggaacagctggatcaccacaacctgtggcagctggaaaaccgcatcaac
gaagtgctggcgcaactggggttagatcctaacgttgcgctgtcgtcgctttccggcggc
tggttgcgtaaagcggcattaggacgcgcgctggtgagtaatccgcgcgtgctgttgctt
gatgaaccgacaaaccacctggatattgaaaccatcgactggctggaagggtttttgaaa
actttcaacgggacgattattttcatctcccacgaccgttcgtttatccgcaatatggcg
acgcgcattgttgatctcgatcgcggcaagctggtgacctatccagggaattacgaccag
tacctgctggaaaaagaagaagccctgcgcgtggaagaattacaaaatgccgagttcgat
cgcaaactggcgcaggaagaggtgtggatccgccaggggatcaaagcacgccgtacccgt
aatgaaggccgcgtacgcgccctgaaagcgatgcgtcgcgaacgtggtgaacgtcgcgaa
gtgatgggtaccgcaaagatgcaggtggaagaggccagccgctccggtaaaatcgttttc
gaaatggaagacgtttgctaccaggttaacggtaagcaactggtgaaagatttttctgcc
caggttctacgtggcgacaaaattgccctgattggtccgaatgggtgcggcaaaaccacg
ctgctaaaactgatgctcggtcagcttcaagcggacagcgggcgtattcacgttggcacc
aaactggaagtggcttatttcgatcagcaccgcgcggaactggatcccgataaaacggtg
atggataaccttgccgaaggtaagcaagaggtgatggttaacggcaagccacgccacgta
ttgggctatttgcaggactttctgttccatccgaaacgggcgatgacgccggtacgtgcg
ctttctggcggtgagcggaaccgcttgctgctggcgcgtttgttcctcaaaccaagcaac
ttattgattcttgacgaaccgaccaacgatcttgatgtcgaaacgctggaactgctggaa
gaactgatcgacagctatcagggcacggtattgctggttagccacgatcgtcagtttgtc
gataacaccgttacagaatgttggatcttcgaaggcggcggtaaaattggtcgttatgtc
ggcggttatcatgatgcccgtggtcagcaagagcagtatgtggcgctcaaacagcctgcg
gtgaaaaaaaccgaagaagccgccgcggcaaaagcagaaactgtaaaacgcagcagtagc
aaactaagctataaattgcagcgcgaactggagcagctaccgcaattgctcgaagatctg
gaggcgaagctggaagccctacagacgcaagtggcggatgcttccttcttcagtcagccg
catgagcagacgcaaaaagtgcttgctgatatggctgctgcagagcaggagctggagcaa
gcctttgaacgctgggagtatcttgaagcgttaaaaaatggtggctga
              
                            

Download fasta file
RegulonDB