RegulonDB RegulonDB 10.9: Gene Sequence
pqiA gene sequence


Size: 1254        A: 236  T: 363  G: 357  C: 298

Fasta

 

>pqiA E. coli K12. Version NC_000913.3 GI:556503834
atgtgcgaacatcatcatgccgcgaagcacatcctgtgctcgcagtgtgacatgctggtg
gcgttaccgcgccttgagcatggtcagaaagcggcatgtccccggtgtggcacaacgtta
accgtggcgtgggatgcccctcggcagcgtcccaccgcctatgcgttggctgcactgttc
atgctgttgctgtccaacttgtttccttttgtgaatatgaacgttgcaggagttaccagt
gaaattacattactggaaattcccggcgtgcttttttctgaggactacgccagcctcggc
acctttttcctgttgtttgtgcaactggttcccgcgttttgtctgataaccattctgtta
ctggtgaatcgcgcggaattaccggtccgtttaaaagagcaactggcacgggtgcttttt
caactcaaaacctggggaatggcggagattttcctcgcgggtgtgctggtcagtttcgtt
aaactgatggcttacggcagcattggggtaggcagcagctttctcccctggtgtttattt
tgtgtcctgcaactgcgcgcttttcagtgcgttgatcgtcgctggttatgggacgacatc
gccccgatgccagaactgcgccagccgctaaaaccaggcgtcacggggatacgtcagggg
ctgcgttcgtgctcctgttgtacggcaatccttcctgctgatgaacccgtgtgcccgcgt
tgtagtaccaaagggtacgttcggcgtagaaacagcctgcagtggacactcgcgctgctt
gtaacgtccatcatgctgtatcttccggctaatattttgcccatcatggtgacggattta
ttaggctcgaagatgccgtcgacgattctcgctggggtcattctgttatggagcgaaggc
tcttatcccgtcgctgcggtgatctttctggccagtattatggtgccaacgttaaagatg
atcgccatcgcgtggctgtgttgggatgccaaagggcatggcaagcgcgacagtgaaaga
atgcatttgatttatgaagttgttgagtttgtaggccgctggtcgatgattgacgttttc
gttatcgcggtgctctcggcgctggtgcgtatgggaggtttaatgagtatttatccggca
atgggtgcattaatgtttgctttagtcgtcataatgacaatgttttctgctatgacgttt
gacccgcgtttgtcgtgggatcgtcaacctgaatcagagcatgaggagtcctga
              
                            

Download fasta file
RegulonDB