RegulonDB RegulonDB 10.9: Gene Sequence
pqiB gene sequence


Size: 1641        A: 437  T: 380  G: 457  C: 367

Fasta

 

>pqiB E. coli K12. Version NC_000913.3 GI:556503834
atggaatctaataatggggaagccaaaatccagaaagtgaagaactggtctcccgtgtgg
atatttcctatcgtcacggcgctcattggggcctgggttcttttttatcattacagccat
cagggaccggaagtgaccctgatcaccgcgaatgcggaaggaattgaaggtggcaaaacc
accattaaaagccgtagcgttgacgtcggcgtggttgaaagcgccacactggctgatgat
ttgacgcacgttgaaatcaaagcgcggctgaattccggtatggaaaaattgctgcataaa
gacaccgtcttttgggtggtgaaaccgcagattggtcgcgaagggattagcggcctggga
acgctgctgtctggagtttatatcgaactgcagccaggcgcgaaaggcagcaaaatggat
aaatacgatttgctggactcgccaccgttggccccgcctgatgcgaaaggtatccgtgtg
attctcgatagcaaaaaagccgggcagctctcgccaggagatccggtgctgttccgtggc
tatcgggtaggttcggttgaaaccagcaccttcgatacacaaaaacgcaatatcagctat
caactgttcatcaatgcaccttatgaccgactggtgaccaacaatgttcgcttctggaaa
gatagtggcattgcggttgatctgacgtcagcagggatgcgtgtggagatgggctcattg
acaacgctgctgagtggcggtgtcagctttgatgtgccggaaggtctggatttagggcag
ccagtggcaccgaaaacagctttcgttttgtatgatgatcagaagagcattcaggattcg
ttgtacaccgatcacattgattatctgatgttctttaaagattcggtacgcggtctgcaa
ccgggagctccggtagagttccggggtattcgcctgggtaccgtaagcaaagtgccattc
tttgcgccgaatatgcgtcagacatttaacgatgattaccgtattccggtactgattcgt
atcgagccagagcggctgaaaatgcagcttggcgaaaatgcggatgttgttgagcacctt
ggcgaattgttgaaacgtggtttacgcggatcgctgaaaaccggaaacctggtcactggt
gcactgtatgttgatctcgatttctatccaaatacgcctgcaataaccggtattcgtgaa
tttaatggttatcagattatcccgaccgttagcggcggcctggcgcaaatccagcaacga
ctgatggaagcgttggataagatcaacaaactgccattgaatccgatgattgaacaggca
accagtacgctttctgaaagtcagcgcacaatgaaaaacctgcaaacgacgctggatagc
atgaacaagatcctcgctagccagtcgatgcagcagttgccgacggatatgcagtcaacg
ttgcgtgaattgaatcgcagcatgcagggcttccagcctggctccgcagcctacaacaag
atggtggcggatatgcagcgccttgatcaggtgttgcgagaactgcaaccggtgctgaaa
acgctcaatgagaagagtaacgcgctggtatttgaagcgaaggacaaaaaagatccagag
ccgaagagggcgaaacaatga
              
                            

Download fasta file
RegulonDB