RegulonDB RegulonDB 10.9: Gene Sequence
pqiC gene sequence


Size: 564        A: 141  T: 129  G: 165  C: 129

Fasta

 

>pqiC E. coli K12. Version NC_000913.3 GI:556503834
atgaaaaagtggctagtgacgattgcagcactgtggctggccggatgcagctccggcgaa
attaataaaaactattaccagttacctgtggtgcagagcggtacacaaagtaccgccagc
cagggcaatcgtctgttatgggtagagcaggtcactgttcctgactatctggcggggaat
ggtgtggtttatcaaaccagtgatgtgaagtatgtgattgccaacaacaacttgtgggcc
agcccgttggatcaacagttgcgcaacaccctggttgccaacctgagtacgcaactgccc
ggctgggtggttgcctcccagcctctgggaagcgcccaggacacgctcaatgttaccgta
acggagtttaacggtcgctatgatggcaaggtcattgtcagtggtgagtggctgttgaac
caccagggacaactgatcaaacgtccgttccgtctggaaggagtgcaaactcaggatggt
tacgatgagatggttaaagtgctggccggtgtctggagtcaggaagccgcttctattgca
caagagataaagcgtctaccttaa
              
                            

Download fasta file
RegulonDB