RegulonDB RegulonDB 10.9: Gene Sequence
ycbZ gene sequence


Size: 1761        A: 418  T: 431  G: 468  C: 444

Fasta

 

>ycbZ E. coli K12. Version NC_000913.3 GI:556503834
ttgaccattacgaaacttgcatggcgtgacctggttcctgataccgatagctatcaggaa
atatttgctcagccacatttgattgacgaaaacgatcctttattcagtgatactcaaccg
cggctgcaatttgcgctggagcagttgctgcatacgcgagcatcctcctcttttatgctg
gcgaaggccccggaagagtctgagtatctgaatcttattgccaatgccgcgcgtacgcta
caaagcgatgcaggccaactggtgggcggtcactatgaggtttccggccactccatccgc
ttacgtcacgcagtgagtgcagatgataattttgcgactttaacgcaagttgtcgctgcc
gactgggtagaagcggagcaactctttggctgcctgcgccagtttaatggcgacattacc
ctgcagcctggtctggtgcatcaggcaaatggcggtattctcattatctctttgcgtaca
ctgctggcgcaacctctgctgtggatgcggctgaaaaatatcgttaaccgcgagcgtttt
gactgggttgcgtttgatgagtcgcgccctctccccgtctctgtgccttcgatgccattg
aagctgaaagtcattctggtaggcgaacgcgaatcattggctgatttccaggagatggag
ccagagctttcagagcaggctatttatagcgaatttgaagatactctgcagattgtcgat
gcggagtcagtaacccagtggtgtcgctgggtgacatttaccgccagacataatcactta
cctgcaccgggagcggatgcctggccgatacttatccgcgaagcagcacgctacaccggt
gaacaagaaacacttccgcttagcccgcagtggatcctccgccagtgtaaagaggtcgcc
tccctgtgtgatggcgacaccttctccggcgagcagctaaacttaatgctgcagcagcgt
gaatggcgcgaaggtttcctcgctgaacgtatgcaggatgagatccttcaggagcaaatc
ctgattgaaaccgaaggcgaacgcatcgggcaaattaacgccctttcggtcattgaattt
ccgggtcatccacgcgcttttggcgaaccttctcgcattagctgcgttgtgcatattggc
gatggtgaattcaccgacatcgaacgcaaagcggagcttggcggcaatatccatgcgaaa
gggatgatgatcatgcaagcgttcctgatgtcggaactacagcttgagcaacagatcccc
ttctcagcatcgctgacatttgagcagtcatacagtgaagttgatggagatagtgcctcg
atggctgaactctgcgccctgataagcgccctcgccgatgtgccggtgaatcagagtatc
gctatcacaggttcagtcgatcagttcggtcgcgcccagccggtcggtggtttaaatgag
aaaatcgaaggcttctttgctatttgccagcaacgtgagttaaccgggaaacaaggtgtc
attatccccacagctaacgttcgccatttaagtcttcacagtgaactggtgaaagcggta
gaagaaggcaaattcaccatctgggcagtagacgatgtgactgacgcactgccgttatta
ttaaatctggtgtgggatggcgaaggccaaacgacgctgatgcaaaccatccaggaacgt
atcgcgcaagcatcgcaacaggaaggacgtcaccgttttccatggccattacgttggctg
aactggtttattccgaactga
              
                            

Download fasta file
RegulonDB