RegulonDB RegulonDB 10.9: Gene Sequence
yccS gene sequence


Size: 2154        A: 451  T: 578  G: 559  C: 566

Fasta

 

>yccS E. coli K12. Version NC_000913.3 GI:556503834
atgctaagtcctttgctcaaacgctatacctggaacagcgcctggctgtattacgcgcgt
atttttattgcgctttgtggaaccacagcgtttccgtggtggctgggtgatgtaaaactg
acgattccgctaacgctggggatggtggcagcggcgctgaccgatctcgatgaccgactg
gcgggacgtttgcgtaacctcatcattacgctgttctgcttttttatcgcctcggcctca
gtagaattgctgtttccctggccctggctatttgcgattggcttaacgctctctaccagc
ggcttcattttgctcggcggtctgggtcaacgctatgcaacaattgccttcggtgcattg
ctgatcgccatttacactatgttgggaacatcactgtatgagcactggtatcagcagccg
atgtatctgctggccggtgccgtctggtacaacgtcctgacacttattggtcatctgctg
ttcccggtccgcccgctgcaggacaacctggcgcgttgctatgaacaactggcgcgttat
cttgagctcaagtcgcgcatgtttgatcctgatattgaagatcaaagccaggcaccgctg
tacgatttggctctcgccaacggtctgctgatggcgacattgaatcagacgaaactctcg
ctgctgacccgcttacgtggcgatcgtggtcaacggggaacgcgtcgcacgctgcattat
tactttgtcgcacaggatattcacgagcgtgccagctcttctcatattcagtatcaaaca
ttgcgtgaacattttcgccacagcgacgtgctgttccgttttcagcggctgatgtcgatg
cagggccaggcgtgccagcaactgtcacgctgtattttgttgcgtcagccttatcaacat
gatccgcattttgagcgcgcttttacgcatattgatgctgcgctggagcggatgcgcgat
aacggcgcacccgccgatttactcaaaacactgggatttttgctgaacaatttacgcgcc
attgatgcccaactggcaacaattgaatcagaacaggcccaggcactaccccataataat
gacgaaaatgagctcgctgatgacagcccgcacgggttgagtgatatctggctgcgtctt
agccgtcacttcacgccggaatccgccctcttccgtcatgcggtaagaatgtcgctggtg
ttgtgcttcggctacgccatcattcagataaccggaatgcatcacgggtattggatcttg
ctgacaagtttgtttgtctgccagccaaactataacgccacgcgccaccgcctgaagtta
aggattattggtacgctggtaggtatcgccattggcattcctgtgctgtggtttgtgcca
tcactggaagggcagctggtgctgctggttattaccggcgtgctcttttttgccttccgt
aacgtgcaatacgctcatgcaacgatgttcatcacacttttggtgctactgtgttttaac
ttactgggtgaaggttttgaagtagcgttacctcgcgtaatcgatacgctgattggttgt
gccattgcgtgggcggcagtgagctacatctggcctgactggcagtttcgcaatctgccg
cgcatgctcgaacgcgccacagaggccaactgtcggtatctcgatgccatactggagcaa
taccatcaggggcgtgataaccgtctggcgtatcgtattgcccgccgcgatgcacacaac
cgtgatgctgagctggcgtcggtggtatcaaatatgtccagcgagccgaacgttaccccg
caaattcgcgaagccgcgtttcggttgctgtgccttaaccatacgtttaccagctatatc
tcagccctcggtgctcaccgggagcagttaactaatcctgaaattctggcgtttcttgat
gacgcagtttgctatgttgatgacgcgttacatcatcaacctgctgatgaagaacgcgtc
aatgaggcattagctagcctgaaacagcggatgcagcaacttgaaccacgggcagacagc
aaagaacctctggtcgtacaacaagttggattattgattgcattactgcctgagattggt
cgtctgcaacgccagattactcaagttccgcaggaaactcctgtttcggcgtaa
              
                            

Download fasta file
RegulonDB