RegulonDB RegulonDB 10.9: Gene Sequence
mgsA gene sequence


Size: 459        A: 114  T: 103  G: 122  C: 120

Fasta

 

>mgsA E. coli K12. Version NC_000913.3 GI:556503834
atggaactgacgactcgcactttacctgcgcggaaacatattgcgctggtggcacacgat
cactgcaaacaaatgctgatgagctgggtggaacggcatcaaccgttactggaacaacac
gtactgtatgcaacaggcactaccggtaacttaatttcccgcgcgaccggcatgaacgtc
aacgcgatgttgagtggcccaatggggggtgaccagcaggttggcgcattgatctcagaa
gggaaaattgatgtattgattttcttctgggatccactaaatgccgtgccgcacgatcct
gacgtgaaagccttgctgcgtctggcgacggtatggaacattccggtcgccaccaacgtg
gcaacggcagacttcataatccagtcgccgcatttcaacgacgcggtcgatattctgatc
cccgattatcagcgttatctcgcggaccgtctgaagtaa
              
                            

Download fasta file
RegulonDB