RegulonDB RegulonDB 10.9: Gene Sequence
yccU gene sequence


Size: 414        A: 101  T: 88  G: 126  C: 99

Fasta

 

>yccU E. coli K12. Version NC_000913.3 GI:556503834
atgaaagaaaccgatattgcaggcattttaacgtccactcacaccattgcgctggtgggg
gcaagcgacaaacccgatcgtcccagctatcgcgtgatgaaatatctactcgaccagggg
tatcacgtcattccggtttcgccaaaagttgccggcaaaacgctgctgggccagaagggg
tatggcacgctggcagacgttccggaaaaagtcgatatggtcgatgttttccgtaattca
gaagcggcgtggggcgtggcacaggaagctattgccattggcgcgaaaactctctggatg
caactgggggtgattaatgagcaagcggcagtactggcacgggatgccgggttaaatgtg
gtgatggatcgctgcccggctattgagatccctcgcctgggcctggccaaataa
              
                            

Download fasta file
RegulonDB