RegulonDB RegulonDB 10.9: Gene Sequence
rlmI gene sequence


Size: 1191        A: 274  T: 300  G: 331  C: 286

Fasta

 

>rlmI E. coli K12. Version NC_000913.3 GI:556503834
atgagtgtacgtttagtgttagccaaagggcgcgaaaaatcattacttcgtcgccatccg
tgggtcttttccggggccgttgcccgcatggaaggtaaagccagcctcggtgaaaccatc
gatattgttgatcatcagggaaaatggttagcacgcggcgcttattcgccagcttcgcaa
atccgggcgcgcgtctggacgtttgacccgtctgagtctatcgacattgcttttttttcc
cgccgtttgcaacaagcacaaaaatggcgtgactggctggcgcaaaaagatggcctcgac
agctatcgtttaatcgccggagaatctgatggcctgccgggtattactatcgatcgtttc
ggtaattttctggtgctgcaactgctgagtgctggggcagaatatcagcgcgcggcatta
attagtgccctgcaaacgctgtacccggaatgttcgatttacgatcgcagcgacgtcgcg
gtacgtaaaaaagaaggaatggagctgacccagggccccgtcaccggcgagttgccacct
gccctgctgccgattgaagaacacggaatgaaactgctggtggatattcagcacggacac
aaaacgggctactacctggaccagcgtgatagccgcctggctacccgccgctacgttgaa
aataaacgtgtgctgaactgtttctcctataccggtggtttcgccgtatcggcactgatg
ggcggttgcagccaggttgtcagcgttgatacctcccaggaagcgctggatattgcacgg
cagaacgttgagctgaacaaactggatctgagcaaggctgagtttgtccgtgatgatgtc
tttaaattgctgcgtacttatcgcgatcgcggtgaaaaatttgacgttatcgtgatggac
ccgccgaagtttgttgagaataaaagccagttgatgggcgcgtgtcgtggttataaagac
atcaacatgctggcgattcagctgctgaatgaaggcggtattctcctgactttctcctgt
tccggtctgatgaccagcgatttatttcagaaaatcatcgcggatgccgcaattgatgcc
ggtcgtgatgtacaatttatagagcagttccgtcaggcagccgatcatccggtgatcgct
acctatccggaagggctatatctgaaagggtttgcctgtcgcgtcatgtaa
              
                            

Download fasta file
RegulonDB