RegulonDB RegulonDB 10.9: Gene Sequence
yccX gene sequence


Size: 279        A: 70  T: 63  G: 89  C: 57

Fasta

 

>yccX E. coli K12. Version NC_000913.3 GI:556503834
atgtcgaaagtctgcataattgcctgggtttacgggcgagttcagggcgtaggatttcgc
tacaccacacagtacgaagcgaaaagactgggtttaaccgggtacgccaaaaatcttgac
gatggcagcgtggaagtggttgcttgcggtgaagaagggcaggtggaaaaattaatgcag
tggttaaagagtggcggcccgcgttctgcgcgtgtagaacgggtgctcagcgagccgcat
catccctcgggggaattaaccgattttcgtatccgttaa
              
                            

Download fasta file
RegulonDB