RegulonDB RegulonDB 11.0: Gene Sequence
etp gene sequence


Size: 447        A: 112  T: 101  G: 127  C: 107

Fasta

 

>etp E. coli K12. Version NC_000913.3 GI:556503834
atggcccaactaaaatttaactcaatcctggtggtttgtaccggcaacatttgccgttcg
cccattggcgagcgcttgctgcgtaaacgtctgccgggcgtaaaagtcaaatcggcaggt
gttcatggtctggtaaaacaccctgcagatgcgacagcggcagatgttgccgctaatcat
ggcgtatctcttgaaggacatgccggacgtaagctcactgctgagatggcacgaaattac
gatctgattctggcaatggagtcggaacatattgctcaggttaccgcaattgctcccgag
gtccgcgggaagacaatgctgtttgggcaatggctggaacagaaagagatcccggatccc
tatcgtaaaagtcaggacgcatttgaacatgtctacggtatgttggagcgcgccagtcag
gaatgggcgaagcgcctcagccggtaa
              
                            

Download fasta file
RegulonDB