RegulonDB RegulonDB 10.9: Gene Sequence
gfcE gene sequence


Size: 1140        A: 297  T: 262  G: 302  C: 279

Fasta

 

>gfcE E. coli K12. Version NC_000913.3 GI:556503834
atgaaaaagaacatttttaagttttcggtactgacattggctgttctgtctttgacagca
tgtacccttgttcctggtcagaatttatcgaccagtaacaaggatgtcattgaactacct
gacaatcagtatgacctggacaaaatggtcaatatctatcccgtcacgccaggattgatt
gatcagttgcgcgccaaaccgattatgtcgcaggctaacccggagctggagcagcaaatc
gcaaactatgaatatcgtatcgggattggtgatgtgttgatggttacggtctgggatcac
ccggaactaaccacccccgcagggcaataccgtagcgccagtgataccggcaactgggtt
aacgccgatggtgcgattttctacccctatattggtcgcctgaaagtggccgggaaaaca
cttacccaggtacgcaacgagattacagcgcgtctcgattcagtcattgaaagcccgcaa
gtcgatgtcagcgtcgcggcgttccgatcgcaaaaagcgtacgtcaccggcgaagtcagc
aaatcgggtcagcagccgattaccaatattcctctgaccatcatggatgcgattaacgcc
gcgggcggtctgaccgcagatgcagactggcgcaacgtggtgctcacccagaatggcgta
aagaccaaagtgaacctctatgcgctgatgcagcgtggcgacttgcgccagaacaaactg
ctgcacccgggcgatattttatttattccgcgcaacgatgatctgaaagtcttcgtgatg
ggtgaagtgggtaaacagagcacgctgaaaatggaccgcagcggtatgaccctggcggaa
gcgctgggtaacgctgagggtatgaatcaggatgtcgctgatgcgacggggatttttgtt
attcgtgcaacgcaaaacaagcagaatggcaaaatcgccaatatttatcagctgaatgcg
aaggacgcatcggcaatgatactcggaacggaattccagcttgaaccttacgacattgtt
tatgtcactaccgcgccgctggctcgttggaaccgtgtgatttctctgctggtaccgacg
atttccggggtgcatgacctgacagagacttcacggtggattcaaacatggcccaactaa
              
                            

Download fasta file
RegulonDB