RegulonDB RegulonDB 10.9: Gene Sequence
gfcD gene sequence


Size: 2097        A: 505  T: 502  G: 554  C: 536

Fasta

 

>gfcD E. coli K12. Version NC_000913.3 GI:556503834
atgaagaagaattcttatcttttaagctgcctggccattgccgtctccagtgcctgtcat
gctgaagtattaacctacccggatccgctgggttcgtcgcaatcagactttggcggcaca
ggattgttgcagatgccaaatgcgcgcatcgcaccggaaggtgaattcagcgtcaactac
cgggataacgatcaataccggttctactccacctccgtggcgctgttcccatggctggaa
ggcaccattcgttatacggatgtgcgcacacgcaaatatagccagtgggaagatttcagc
ggcgatcagtcatacaaagacaaatcattcgattttaaacttcgcctgtgggaagaaggt
tactggctaccgcaagtggcgtttggtaaacgtgatattgctggtacgggtctgtttgac
ggtgagtatctggtggccagcaagcaagcggggccatttgatttcaccctcgggatggca
tggggctacgccggtaatgcgggcaatattaccaacccgttttgccgggtgagcgataaa
tattgtcatcgcgcagagtctcacgatgcgggcgatatcagctttagcgatatctttcgt
ggcccggcttccatctttggcggcattgagtatcaaacgccgtggaatcccctgcgtctg
aaactcgaatacgatggaaacaattaccagaatgatttcgctggcaaactgcctcaggca
agccatttcaacgtcggcgcagtttatcgcgctgccagctgggcagatctcaacctgagt
tatgaacgcggtaacacgttgatgtttggcttcacgttacggaccaatttcaacgatctg
cgccctgccctgcgcgatacgccaaaaccggcatatcaacctgcgcctgaatctgaagga
ttgcagtacaccacggtagcaaaccaacttaccgccctgaagtataacgcgggctttgac
gcgccagaaattcagctacgcgataagacactgtatatgtctggtcagcaatacaaatac
cgtgactctcgtgaagcggtcgatcgtgccaaccggattctggtgaataacctgccgcaa
ggcgttgagaagattagcgtgacgcaaaagcgcgagcatatggcgatggtgactaccgaa
accgacgtagccagcctgcgcaaacagctggcaggtacagcgcctggtcaatcagagcca
ctgcaacaacaacgtgttgaagctgaagatctttctgcctttggtcggggctaccgtatt
cgtgaagatcgctttagctactctttcaacccaacactttcacagtcgctgggcggcccg
gaagatttctatatgttccagctggggctgatgtccagtgcccgctactggtttaccgac
cacctgctgcttgatggcggtattttcaccaatatttacaacaactacgacaagtttaag
tcttcgctgttgcccgcggactctaccctgccccgcgtgcgcacgcatatccgtgactac
gttcgcaatgacgtttatctcaacaacttgcaggcgaactattttgctgacttaggcaat
ggtttctatggccaggtgtatggcggttatctggaaacgatgtacgccggtgtcggttcc
gagctgctttatcgcccgctagatgcctgctgggcgctgggtgtggacgttaactacgtg
aagcaacgtgactgggacaacatgatgcgtttcaccgattattccacgccaacaggtttc
gtgacggcttactggaacccgccgacgctcaatggcgtactgatgaaacttagcgttggg
caatatctggcaaaagataaaggcgcaacgatcgacgtcgccaaacgctttgacagcggc
gtggcggtaggggtatgggcggcaatcagtaacgtatctaaagatgactacggcgaaggc
ggctttagtaaaggtttttatatctcgattccattcgacttgatgaccattggacctaac
cgcaaccgcgcggtggtttcgtggacaccattgacgcgtgatggtggacaaatgctgtca
cgcaaataccagctctatccaatgacggcagagcgagaagtaccggttggacaataa
              
                            

Download fasta file
RegulonDB