RegulonDB RegulonDB 10.8: Gene Sequence
gfcC gene sequence


Size: 747        A: 171  T: 185  G: 196  C: 195

Fasta

 

>gfcC E. coli K12. Version NC_000913.3 GI:556503834
atgaataaattacagtcgtatttcattgccagcgtactttacgtaatgacaccccatgcc
tttgcgcaaggaacggtgactatttatctgcctggcgaacaacagacactttccgttggc
cccgtggaaaatgttgtccagttggtgacacaaccgcaactgcgcgatcgcctctggtgg
cctggtgccttgctgaccgactctgcggcgaaagctaaagcgcttaaagactaccaacat
gtcatggcacagcttgcttcctgggaagcagaagctgacgacgatgtggcggcaacgatt
aaatccgtgcgccagcagttactcaatctcaatatcactggtcgcttaccggtcaaactg
gaccctgattttgtacgagtggatgagaacagcaatcccccgttggtcggggactatacg
ctctataccgtacagcgtccggtgactattactctgctgggtgcggtttctggggccggg
caattgccctggcaggcaggccgtagcgttaccgattatctgcaagatcacccccgcctt
gcaggcgcggacaagaataacgttatggtgattacgcctgagggtgagactgtcgtcgcc
cctgttgccctgtggaataaaagacatgtggaaccaccgcctggcagccagctttggttg
ggcttttctgcgcatgtactgcccgaaaaatatgctgatttaaatgaccagattgtgtct
gttttaacgcaacgtgttcctgactga
              
                            

Download fasta file
RegulonDB