RegulonDB RegulonDB 10.9: Gene Sequence
gfcB gene sequence


Size: 645        A: 170  T: 168  G: 157  C: 150

Fasta

 

>gfcB E. coli K12. Version NC_000913.3 GI:556503834
gtgcgccctcttattttatcgattttcgcactatttcttgcgggatgtacgcacagccag
caaagtatggtcgatacatttcgcgccagccttttcgataatcaggatatcaccgtagcg
gatcagcagatccaggcgttgccttattccactatgtatttacgccttaatgaagggcaa
cgaatctttgtggtactgggatatatagaacaagaacaaagcaaatggttatcccaggat
aacgccatgctggttacccacaatggacgtcttttaaaaaccgtcaaacttaataataat
ctgctggaagtgacaaattccgggcaggaccctctgcgtaacgcgctggcaataaaagat
ggcagccgctggacgcgcgatattctctggagtgaagacaaccattttcgctctgcgacc
ctgagttctactttttcctttgctggattagagacgctgaatattgcgggtcgcaatgtg
ctgtgtaatgtctggcaggaagaggtgacttccacgcggccagaaaaacagtggcaaaac
acattctgggtcgattcggctactggccaggttcgtcaaagtcggcaaatgttaggcgca
ggggttattcccgtagaaatgacgtttcttaaacccgcaccatga
              
                            

Download fasta file
RegulonDB