RegulonDB RegulonDB 10.9: Gene Sequence
insB4 gene sequence


Size: 504        A: 122  T: 106  G: 150  C: 126

Fasta

 

>insB-4 E. coli K12. Version NC_000913.3 GI:556503834
atgccgggcaacagcccgcattatgggcgttggcctcaacacgattttccgccatttaaa
aaactcaggccgcagtcggtaacctcgcgcatacagccgggcagtgacgtcatcgtctgc
gcggaaatggacgaacagtggggatacgtcggggctaaatcgcgccagcgctggctgttt
tacgcgtatgacaggctccggaagacggttgttgcgcacgtattcggtgaacgcactatg
gcgacgctggggcgtcttatgagcctgctgtcaccctttgacgtggtgatatggatgacg
gatggctggccgctgtatgaatcccgcctgaagggaaagctgcacgtaatcagcaagcga
tatacgcagcgaattgagcggtataacctgaatctgaggcagcacctggcacggctggga
cggaagtcgctgtcgttctcaaaatcggtggagctgcatgacaaagtcatcgggcattat
ctgaacataaaacactatcaataa
              
                            

Download fasta file
RegulonDB