RegulonDB RegulonDB 10.8: Gene Sequence
cspH gene sequence


Size: 213        A: 59  T: 54  G: 47  C: 53

Fasta

 

>cspH E. coli K12. Version NC_000913.3 GI:556503834
ttgtcccgtaaaatgacaggaattgtcaaaacctttgatcgcaaaagcggcaaaggattc
attatcccctccgacggtcgtaaagaagttcaggtccatatttccgcattcactccccgc
gacgcagaagtgcttataccaggattacgtgtggaattttgccgcgtaaatggcctgcga
ggaccaacagcggcaaatgtttatctctcttaa
              
                            

Download fasta file
RegulonDB