RegulonDB RegulonDB 10.8: Gene Sequence
cspG gene sequence


Size: 213        A: 62  T: 57  G: 49  C: 45

Fasta

 

>cspG E. coli K12. Version NC_000913.3 GI:556503834
atgtctaataaaatgactggtttagtaaaatggtttaacgcagataaaggttttggcttt
atcactcctgatgatggcagcaaagacgttttcgtccatttcaccgccatccagagcaat
gaattccgcacgctgaacgaaaatcagaaagttgaattttctattgagcaggggcaacgt
ggccccgcggcagcgaacgttgttacgctctaa
              
                            

Download fasta file
RegulonDB