RegulonDB RegulonDB 10.8: Gene Sequence
ymcE gene sequence


Size: 231        A: 59  T: 76  G: 49  C: 47

Fasta

 

>ymcE E. coli K12. Version NC_000913.3 GI:556503834
atgcgccgctggatttcacaaaataatatcaggctccctcgtggagccttttttatatct
gccttatttttcttcaacgctgtatgtatagtaagcgataacctgttgattattgaatct
ttcggggagatggcttataacatttcttacctgaccagggtaccgggaaccaacacctta
ctggcgtgttgctgtcttttaagaccagaagaggttaacagtgaatattga
              
                            

Download fasta file
RegulonDB