RegulonDB RegulonDB 10.8: Gene Sequence
yccM gene sequence


Size: 1074        A: 240  T: 306  G: 284  C: 244

Fasta

 

>yccM E. coli K12. Version NC_000913.3 GI:556503834
atggcagagaataaaagaacccgctggcagcggcggccaggcacgacgggcggcaaatta
ccgtggaatgactggcgtaatgccacgacctggcgtaaagcgacgcaattattactgttg
gcaatgaatatttatattgccatcacgttctggtattgggtgcgctattacgaaacggca
agtagcacgacatttgtcgccagaccgggaggtatcgaaggctggctaccgattgccggg
ctgatgaatctgaaatatagccttgtaacaggtcagttaccgtccgtccacgccgccgcg
atgctgttattggtcgcttttatcgtcatcagtctattactcaaaaaggccttttgctca
tggttatgcccggttggtacgctttctgaattaatcggcgatctcggtaacaaactgttt
ggtcggcaatgtgtccttccccgctggctggatattcctctgcgcggcgtgaagtatttg
ctgttgagtttttttatctatatcgcgttattgatgcccgctcaggcgattcactatttt
atgttgtcgccctacagcgtggtgatggacgttaaaatgctcgatttctttcgtcatatg
gggaccgcgacattaatcagcgtgaccgttttgctgattgccagcctgtttattcgccat
gcctggtgtcgttatctttgcccatatggcgcgctgatgggcgtggtttcgctattgtcg
ccgtttaagattcgtcgcaatgccgaaagttgtatcgactgtggcaaatgcgcaaaaaat
tgcccatcacggatcccggtcgataaattaattcaggtacgaacagtggaatgtaccggc
tgtatgacttgcgtagagtcatgtccggtagcctcaacattgaccttttcactgcaaaaa
cctgcggcaaataaaaaagcctttgcgttgtctggctggttaatgacgctactggttctg
gggattatgtttgcggtgattggttacgcaatgtatgcgggagtatggcaaagcccggtg
ccggaggaattgtaccgacgcttaattccacaagcgccaatgattggtcactaa
              
                            

Download fasta file
RegulonDB