RegulonDB RegulonDB 10.9: Gene Sequence
torS gene sequence


Size: 2745        A: 682  T: 587  G: 763  C: 713

Fasta

 

>torS E. coli K12. Version NC_000913.3 GI:556503834
gtgaatttaaccctgacccgaagactctggatgggctttgccctgatggcgctgttaacc
ctgaccagtaccctggtgggatggtacaacctgcgctttatcagccaggtggaaaaagac
aacactcaggcattgattcctaccatgaatatggcgcgccagttgagcgaagccagcgcc
tgggaacttttcgccgcgcagaacctgaccagtgccgataacgaaaagatgtggcaggcg
caggggcgaatgctcaccgcacaaagcctgaagattaatgcgttgctgcaagcgttacgg
gaacaaggttttgataccaccgctattgaacaacaggagcaggagatctcccgttcgtta
cgtcagcaaggggaactggtggggcagcgtttgcaactgcgccagcaacaacagcaactc
agtcagcagatagtcgctgccgccgatgagatcgcacgcctggcgcaaggtcaggcgaat
aatgcgacaacttccgctggagcgacccaggccgggatttacgatttgatcgaacaagat
cagcgtcaggctgctgaaagtgcactcgatcggctgattgatatcgatcttgagtatgtt
aaccagatgaatgaactgcgccttagcgctctgcgggtgcagcaaatggtgatgaatctg
gggctggagcagatccagaaaaatgcaccaacgctggaaaagcagctcaataatgcggtg
aaaattctgcaacgtcggcaaatacgcattgaagatccgggtgttcgtgcgcaggtcgca
acaacgttaactaccgttagccaatatagcgatttgctggcgctgtatcagcaggacagt
gaaatcagcaatcacctacaaactctcgcacaaaataacatcgcccagttcgcgcagttt
agtagcgaagtcagtcagctggtcgacaccattgagctgcgtaatcagcacggactggcg
catctggaaaaagcgagtgcacgcgggcaatacagcctgttattgctggggatggtttca
ctttgcgcactgattctgatcctctggcgcgtggtttatcgctcagtcacgcgtccactt
gccgaacaaacgcaggcgctgcaacggctgctggacggtgatattgactcccctttcccg
gaaaccgctggcgtacgggagctggataccatcgggcggctgatggatgcgtttcgcagc
aatgttcatgcactgaatcgccaccgcgaacagctggcggcgcaggtcaaagcgcgtaca
gctgaattgcaggaactggtgatagaacaccgacaggcacgggcggaagcagaaaaagcc
agccaggcaaaatcggcgtttctggcggcgatgagccatgagatccgcacaccgctgtac
ggtattctcggcactgctcaactgctggcagataaccccgcacttaacgcccagcgtgat
gatttgcgggcaattactgactctggtgaatcgttgctgaccatcctcaacgatattctc
gattattccgctatcgaagcaggtggcaagaatgtttcggtcagcgatgagccctttgaa
ccgcgcccgctgctggaaagtaccctgcaattaatgagcggacgggtgaaaggtcgcccg
attcgcctggcaacggcaattgccgatgatatgccgtgcgcgttaatgggcgatccacga
cgtattcgtcaggttataaccaacctgttgagcaacgccctgcgttttactgacgaaggg
tacattatcctgcgtagtcgcactgatggcgagcaatggctggtcgaagtggaagacagc
ggctgcggtattgatcccgcgaaactggcagaaatcttccagccatttgtgcaggtaagc
ggcaaacgcggcggcaccgggctgggactgactatcagtagccgtctggcccaggcgatg
ggcggcgaactgagcgccaccagcacgccggaggttggaagctgtttttgtttacgcttg
ccgttacgtgttgccacggcacccgtgccaaaaacagtcaatcaggcggtgcgtcttgac
ggtttacgtttgctgttaattgaagataacccgctaacccagcgaattaccattgagatg
ctgaaaaccagtggtgcgcagattgttgctgttggcaatgccgcgcaggctttagagaca
ctgcaaaatagcgaaccgtttgctgccgcactggtggattttgatctgccggatatcgac
ggcattacgcttgcccgacaactggcacagcaatatccgtcgctggttttgattggcttt
agcgcccatgtcattgacgaaacgctgcgccagcgtaccagttcattattccgcgggatt
atccctaaaccggtgccgcgtgaagtgctcggtcagttactggcgcactatctccaactg
caagtcaataatgatcaatcgctggatgtatcgcaactcaatgaagatgctcagttaatg
gggacggagaagatccacgaatggctggtattatttacacaacatgccctgccgcttctc
gatgaaatcgacattgcccgcgccagtcaggatagcgagaaaataaagcgtgccgcgcat
cagctaaaaagcagttgctcgagtctgggaatgcatatcgccagccagctatgcgcacaa
ctggagcagcagccattatctgccccccttccacacgaagaaattacacgcagtgttgcc
gctctggaagcatggttgcataagaaagacctgaacgcgatttga
              
                            

Download fasta file
RegulonDB