RegulonDB RegulonDB 10.9: Gene Sequence
torT gene sequence


Size: 1029        A: 234  T: 245  G: 303  C: 247

Fasta

 

>torT E. coli K12. Version NC_000913.3 GI:556503834
atgcgcgtactgctatttttacttctttcccttttcatgttgccggcattttcggctgat
aacctgttgcgctggcatgatgcgcagcatttcacggtgcaagcctctacgccgcttaaa
gccaaacgcgcatggaaactgtgcgcgctttatcccagcctgaaagattcatattggtta
tcgttgaactatggtatgcaggaggctgctcgccgctacggtgtggatttaaaagtgctg
gaggcaggcggctacagccagttggctacccagcaagcacaaatcgaccagtgtaaacag
tggggcgcagaggccattttgctcggtagtagcacgacctcatttcccgacctgcaaaag
caggtagcaagtctgccggtgatcgaactggtaaatgctattgatgctccccaggtgaaa
agccgcgttggtgtgccctggtttcagatgggctatcaaccggggcgatatctggtgcaa
tgggcgcacggtaaaccactgaatgtgctgttgatgcccggacccgataacgccgggggc
agtaaggagatggtcgagggttttcgcgcagccattgccggaagcccggtgcgtattgtt
gatattgcgcttggtgataacgatattgaaatccagcgtaacctgttgcaggagatgctg
gaacgccatccagaaatcgacgtcgttgccggaacggccattgcggcagaggcggcaatg
ggggaagggcgtaacctgaaaacgccgcttaccgtggtgtcgttttatctttcacatcag
gtgtatcgcgggctgaagcggggaagagtgattatggctgccagcgatcaaatggtctgg
cagggggaactggcggttgagcaggccatcaggcaattacaggggcaatcggtttctgat
aatgtcagcccaccgattttagttctgacgccgaaaaatgccgaccgtgaacatattcgc
cgctcgctgtcaccagggggatttcgtccggtctatttttatcagcacacatcagcggct
aagaaataa
              
                            

Download fasta file
RegulonDB