RegulonDB RegulonDB 10.9: Gene Sequence
rutC gene sequence


Size: 387        A: 90  T: 88  G: 103  C: 106

Fasta

 

>rutC E. coli K12. Version NC_000913.3 GI:556503834
atgccaaaatccgtaattattcccgctggcagcagcgcaccgctggcccccttcgttccc
ggcacgctggctgatggcgtggtgtatgtctccggtacgctggcttttgatcaacataat
aacgtgctgtttgccgatgacccaaaggcgcaaacccgccacgttctggaaactatccgc
aaggtgatcgagacggcgggtggcacgatggcggatgtgaccttcaacagcatctttatt
accgactggaaaaattacgccgcgattaacgaaatctacgccgagttttttccgggtgat
aaaccggcgcgattctgcattcagtgcggactggtaaaacctgacgcgctggtggaaatc
gccacaattgcgcatatcgccaagtga
              
                            

Download fasta file
RegulonDB